Transcript: Human XM_017005112.1

PREDICTED: Homo sapiens lysyl oxidase like 3 (LOXL3), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LOXL3 (84695)
Length:
2449
CDS:
789..1967

Additional Resources:

NCBI RefSeq record:
XM_017005112.1
NBCI Gene record:
LOXL3 (84695)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017005112.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046211 CGGTATGAGTGTGCCAACTTT pLKO.1 1656 CDS 100% 5.625 7.875 N LOXL3 n/a
2 TRCN0000299631 CGGTATGAGTGTGCCAACTTT pLKO_005 1656 CDS 100% 5.625 7.875 N LOXL3 n/a
3 TRCN0000303670 ACTGGGACTCTGGGAATATAA pLKO_005 1132 CDS 100% 15.000 10.500 N LOXL3 n/a
4 TRCN0000303671 CATCTTCACTCACTATGATAT pLKO_005 1547 CDS 100% 13.200 9.240 N LOXL3 n/a
5 TRCN0000046210 CCAGACCAGCAACCAGATTAT pLKO.1 1943 CDS 100% 13.200 9.240 N LOXL3 n/a
6 TRCN0000303739 GGACCCACAGTGCCAAATATG pLKO_005 206 5UTR 100% 13.200 9.240 N LOXL3 n/a
7 TRCN0000303672 TTACCAACAATGCAATGAAAT pLKO_005 1822 CDS 100% 13.200 9.240 N LOXL3 n/a
8 TRCN0000341035 GAGGGCCACAAAGCTAGTTTC pLKO_005 1596 CDS 100% 10.800 7.560 N Loxl3 n/a
9 TRCN0000046212 CCGAGCAGAGTGTGACTGAAT pLKO.1 275 5UTR 100% 4.950 3.465 N LOXL3 n/a
10 TRCN0000046208 CCAGGTTGTCATCAACCCAAA pLKO.1 1778 CDS 100% 0.405 0.284 N LOXL3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017005112.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12839 pDONR223 100% 64.4% 64.4% None 0_1ins648 n/a
2 ccsbBroad304_12839 pLX_304 0% 64.4% 64.4% V5 0_1ins648 n/a
3 TRCN0000468852 ACCGGGGCCACAGCCACGAGAGTT pLX_317 20% 64.4% 64.4% V5 0_1ins648 n/a
Download CSV