Transcript: Human XM_017005171.2

PREDICTED: Homo sapiens macrophage receptor with collagenous structure (MARCO), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MARCO (8685)
Length:
1105
CDS:
122..1090

Additional Resources:

NCBI RefSeq record:
XM_017005171.2
NBCI Gene record:
MARCO (8685)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017005171.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029659 CCAGGGATGTTCAGAATCAAA pLKO.1 542 CDS 100% 5.625 3.938 N MARCO n/a
2 TRCN0000431418 CCTAGCTGTGGTGGTCATCTA pLKO_005 256 CDS 100% 4.950 3.465 N MARCO n/a
3 TRCN0000425995 CTCTTGAGTGAGACCCAACAA pLKO_005 155 CDS 100% 4.950 3.465 N MARCO n/a
4 TRCN0000029662 CCAAATTGCAATGGAGCCTTT pLKO.1 187 CDS 100% 4.050 2.835 N MARCO n/a
5 TRCN0000029660 CCTGGAGATGTATTTCCTCAA pLKO.1 349 CDS 100% 4.050 2.835 N MARCO n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017005171.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07285 pDONR223 100% 56.4% 51.4% None (many diffs) n/a
2 ccsbBroad304_07285 pLX_304 0% 56.4% 51.4% V5 (many diffs) n/a
3 TRCN0000467928 GACCTGATACTATCCCCGGCGCTC pLX_317 26.3% 56.4% 51.4% V5 (many diffs) n/a
Download CSV