Transcript: Human XM_017005383.2

PREDICTED: Homo sapiens carbohydrate sulfotransferase 10 (CHST10), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CHST10 (9486)
Length:
3144
CDS:
726..1796

Additional Resources:

NCBI RefSeq record:
XM_017005383.2
NBCI Gene record:
CHST10 (9486)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017005383.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000103114 GTCTGTGACAAGCACAAGATT pLKO.1 1068 CDS 100% 5.625 3.938 N Chst10 n/a
2 TRCN0000034761 CAGTGGAAGAAAGTGCTGATT pLKO.1 1122 CDS 100% 4.950 3.465 N CHST10 n/a
3 TRCN0000034763 CCTGGTGTCATACCCGACTAT pLKO.1 1628 CDS 100% 4.950 3.465 N CHST10 n/a
4 TRCN0000034760 CCTTGGTACAGGCATGAGATT pLKO.1 1356 CDS 100% 4.950 3.465 N CHST10 n/a
5 TRCN0000034759 CCAGATGTGTACAGTGCCAAA pLKO.1 819 CDS 100% 4.050 2.835 N CHST10 n/a
6 TRCN0000034762 GAAATTCAGAAGCGATTGAAA pLKO.1 1245 CDS 100% 5.625 3.375 N CHST10 n/a
7 TRCN0000103112 CCTTGGTACAGGCATGAGATA pLKO.1 1356 CDS 100% 4.950 3.465 N Chst10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017005383.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07426 pDONR223 100% 99.9% 100% None 696C>G n/a
2 ccsbBroad304_07426 pLX_304 0% 99.9% 100% V5 696C>G n/a
3 TRCN0000475427 TGTTCGCAGTTGGTGGCCTTGTTC pLX_317 38.6% 99.9% 100% V5 696C>G n/a
Download CSV