Transcript: Human XM_017005561.1

PREDICTED: Homo sapiens insulin like growth factor 2 mRNA binding protein 2 (IGF2BP2), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IGF2BP2 (10644)
Length:
2081
CDS:
87..1565

Additional Resources:

NCBI RefSeq record:
XM_017005561.1
NBCI Gene record:
IGF2BP2 (10644)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017005561.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265644 GCCGTTGTCAACGTCACATAT pLKO_005 465 CDS 100% 13.200 18.480 N IGF2BP2 n/a
2 TRCN0000255460 ATCGAGACCCTCTCGGGTAAA pLKO_005 249 CDS 100% 10.800 15.120 N IGF2BP2 n/a
3 TRCN0000146301 CAGTGCTGAGATAGAGATTAT pLKO.1 1109 CDS 100% 13.200 9.240 N IGF2BP2 n/a
4 TRCN0000255466 TCAGGCCAGACAGATTGATTT pLKO_005 665 CDS 100% 13.200 9.240 N IGF2BP2 n/a
5 TRCN0000255467 TTCCCGCATCATCACTCTTAT pLKO_005 1356 CDS 100% 13.200 9.240 N IGF2BP2 n/a
6 TRCN0000255465 ATCAAACAGCTGGCGAGATTC pLKO_005 1452 CDS 100% 10.800 7.560 N IGF2BP2 n/a
7 TRCN0000255464 CTGAAGCATGCCGCATGATTC pLKO_005 859 CDS 100% 10.800 7.560 N IGF2BP2 n/a
8 TRCN0000149002 GCATATACAACCCGGAAAGAA pLKO.1 1054 CDS 100% 5.625 3.938 N IGF2BP2 n/a
9 TRCN0000149224 GCTGTTAACCAACAAGCCAAT pLKO.1 1167 CDS 100% 4.050 2.835 N IGF2BP2 n/a
10 TRCN0000096763 CCTCTCGGGTAAAGTGGAATT pLKO.1 257 CDS 100% 0.000 0.000 N Igf2bp2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017005561.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10208 pDONR223 100% 78.9% 77% None (many diffs) n/a
2 ccsbBroad304_10208 pLX_304 0% 78.9% 77% V5 (many diffs) n/a
3 TRCN0000469479 CACTGCACGGTTCACGCTGAGAAA pLX_317 22.8% 78.9% 77% V5 (many diffs) n/a
Download CSV