Transcript: Human XM_017005614.2

PREDICTED: Homo sapiens aldehyde dehydrogenase 1 family member L1 (ALDH1L1), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ALDH1L1 (10840)
Length:
2868
CDS:
156..2642

Additional Resources:

NCBI RefSeq record:
XM_017005614.2
NBCI Gene record:
ALDH1L1 (10840)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017005614.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221934 GACCCTCATTCACGGAGATAA pLKO.1 518 CDS 100% 13.200 18.480 N ALDH1L1 n/a
2 TRCN0000221937 CTCATCCTCTTTGGGAATGAT pLKO.1 984 CDS 100% 5.625 4.500 N ALDH1L1 n/a
3 TRCN0000028506 CCTGGCCTCGAACTTCTTTAA pLKO.1 1055 CDS 100% 13.200 9.240 N ALDH1L1 n/a
4 TRCN0000221935 CTACGTGGAAATGGCAGTGAA pLKO.1 1376 CDS 100% 4.950 3.465 N ALDH1L1 n/a
5 TRCN0000221936 CTGTGAACAGAAACTGACATT pLKO.1 866 CDS 100% 4.950 2.970 N ALDH1L1 n/a
6 TRCN0000042013 GCACTGTGTTTGTCAACACAT pLKO.1 2500 CDS 100% 0.495 0.347 N Aldh1l1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017005614.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11556 pDONR223 100% 60.6% 59.5% None (many diffs) n/a
2 ccsbBroad304_11556 pLX_304 0% 60.6% 59.5% V5 (many diffs) n/a
3 TRCN0000480253 CCAGTGCGGGGAATGCCATATAAT pLX_317 23.6% 60.6% 59.5% V5 (many diffs) n/a
Download CSV