Transcript: Human XM_017005754.1

PREDICTED: Homo sapiens solute carrier family 66 member 1 like (SLC66A1L), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC66A1L (152078)
Length:
1217
CDS:
149..466

Additional Resources:

NCBI RefSeq record:
XM_017005754.1
NBCI Gene record:
SLC66A1L (152078)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017005754.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263982 ATAGGTGGAGACCTGACAAAT pLKO_005 302 CDS 100% 13.200 9.240 N SLC66A1L n/a
2 TRCN0000263983 ATTCATGTACTACAGGTTAAA pLKO_005 412 CDS 100% 13.200 9.240 N SLC66A1L n/a
3 TRCN0000281605 CGACATGAACACGGATGTAAT pLKO_005 379 CDS 100% 13.200 9.240 N SLC66A1L n/a
4 TRCN0000263981 TAGCTAATGCTATAGTCATTT pLKO_005 842 3UTR 100% 13.200 9.240 N SLC66A1L n/a
5 TRCN0000263980 TCTACGGAAGGAACTTCATTT pLKO_005 559 3UTR 100% 13.200 9.240 N SLC66A1L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017005754.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05062 pDONR223 100% 88.7% 82.6% None (many diffs) n/a
2 ccsbBroad304_05062 pLX_304 0% 88.7% 82.6% V5 (many diffs) n/a
3 TRCN0000466474 GGTTATCGTATTAGTCCACTGGGC pLX_317 100% 88.7% 82.6% V5 (many diffs) n/a
Download CSV