Transcript: Human XM_017005824.2

PREDICTED: Homo sapiens discs large MAGUK scaffold protein 1 (DLG1), transcript variant X40, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DLG1 (1739)
Length:
3831
CDS:
216..1775

Additional Resources:

NCBI RefSeq record:
XM_017005824.2
NBCI Gene record:
DLG1 (1739)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017005824.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000006104 CCTATGAAAGACAGGATAAAT pLKO.1 1224 CDS 100% 15.000 12.000 N DLG1 n/a
2 TRCN0000006102 CCCACAAGTATGTATATGAAT pLKO.1 207 5UTR 100% 5.625 3.938 N DLG1 n/a
3 TRCN0000318830 CCCACAAGTATGTATATGAAT pLKO_005 207 5UTR 100% 5.625 3.938 N DLG1 n/a
4 TRCN0000025405 CCAGTGAATCAACAAGAAGTT pLKO.1 1173 CDS 100% 4.950 3.465 N Dlg1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017005824.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14615 pDONR223 52.1% 57% 4.1% None (many diffs) n/a
2 ccsbBroad304_14615 pLX_304 0% 57% 4.1% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000471116 TTCGAAGCCCGGCTAAACTAAATC pLX_317 13.6% 57% 4.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV