Transcript: Human XM_017005930.2

PREDICTED: Homo sapiens exosome component 7 (EXOSC7), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EXOSC7 (23016)
Length:
2053
CDS:
92..724

Additional Resources:

NCBI RefSeq record:
XM_017005930.2
NBCI Gene record:
EXOSC7 (23016)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017005930.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051071 GAGATCGCTAACACCCTCTAT pLKO.1 158 CDS 100% 4.950 6.930 N EXOSC7 n/a
2 TRCN0000051070 CATACGACTAAGTGTGGAGAA pLKO.1 415 CDS 100% 4.050 5.670 N EXOSC7 n/a
3 TRCN0000438484 AGCACTGCTGGGTTCTCTATG pLKO_005 237 CDS 100% 10.800 7.560 N EXOSC7 n/a
4 TRCN0000434452 CTTAAAGACCCTCTGCATTAG pLKO_005 208 CDS 100% 10.800 7.560 N EXOSC7 n/a
5 TRCN0000433811 CAGAGAGCATCTTCGAGATGA pLKO_005 594 CDS 100% 4.950 3.465 N EXOSC7 n/a
6 TRCN0000428275 CATGTGGTGGATGCTACTCTT pLKO_005 476 CDS 100% 4.950 3.465 N EXOSC7 n/a
7 TRCN0000051069 GCTTCTGGAATGTGGTGGAAA pLKO.1 268 CDS 100% 4.950 3.465 N EXOSC7 n/a
8 TRCN0000429986 AGAAGGTGTACATCGTGCATG pLKO_005 74 5UTR 100% 4.050 2.835 N EXOSC7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017005930.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07829 pDONR223 100% 71.5% 70.4% None (many diffs) n/a
2 ccsbBroad304_07829 pLX_304 0% 71.5% 70.4% V5 (many diffs) n/a
3 TRCN0000471315 CCGAACCAGGACAAAGAAAGTCTG pLX_317 36.6% 71.5% 70.4% V5 (many diffs) n/a
Download CSV