Transcript: Human XM_017005955.1

PREDICTED: Homo sapiens cytoplasmic linker associated protein 2 (CLASP2), transcript variant X14, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CLASP2 (23122)
Length:
7327
CDS:
355..4941

Additional Resources:

NCBI RefSeq record:
XM_017005955.1
NBCI Gene record:
CLASP2 (23122)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017005955.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108259 CCTGACGATCTTTCCCTAGAT pLKO.1 4201 CDS 100% 4.950 6.930 N CLASP2 n/a
2 TRCN0000300966 CCTGACGATCTTTCCCTAGAT pLKO_005 4201 CDS 100% 4.950 6.930 N CLASP2 n/a
3 TRCN0000108258 GCCGTCTTGGTTGAAACTATT pLKO.1 1813 CDS 100% 13.200 10.560 N CLASP2 n/a
4 TRCN0000300901 GCCGTCTTGGTTGAAACTATT pLKO_005 1813 CDS 100% 13.200 10.560 N CLASP2 n/a
5 TRCN0000108256 GCCAGGTCTAATACAGGGTTA pLKO.1 4722 CDS 100% 4.050 3.240 N CLASP2 n/a
6 TRCN0000108257 CCCAGACTTATACCTTTAATA pLKO.1 1687 CDS 100% 15.000 10.500 N CLASP2 n/a
7 TRCN0000300902 CCCAGACTTATACCTTTAATA pLKO_005 1687 CDS 100% 15.000 10.500 N CLASP2 n/a
8 TRCN0000108255 GCCAGTGTTATGATTGTATAA pLKO.1 5245 3UTR 100% 13.200 9.240 N CLASP2 n/a
9 TRCN0000300965 GCCAGTGTTATGATTGTATAA pLKO_005 5245 3UTR 100% 13.200 9.240 N CLASP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017005955.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11679 pDONR223 100% 27.7% 26.6% None (many diffs) n/a
2 ccsbBroad304_11679 pLX_304 0% 27.7% 26.6% V5 (many diffs) n/a
3 TRCN0000467912 TTATGCAAACGTTACGCAGACATC pLX_317 34% 27.7% 26.6% V5 (many diffs) n/a
Download CSV