Transcript: Human XM_017006079.2

PREDICTED: Homo sapiens N-acetylated alpha-linked acidic dipeptidase like 2 (NAALADL2), transcript variant X13, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NAALADL2 (254827)
Length:
10790
CDS:
1109..3445

Additional Resources:

NCBI RefSeq record:
XM_017006079.2
NBCI Gene record:
NAALADL2 (254827)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017006079.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073960 CCCAACACTCATCAACTGTTA pLKO.1 3056 CDS 100% 4.950 6.930 N NAALADL2 n/a
2 TRCN0000073961 GCAAGTTCAGACAGTCACAAA pLKO.1 2311 CDS 100% 4.950 3.960 N NAALADL2 n/a
3 TRCN0000073959 GCCCTTTAATGCACTTGATAT pLKO.1 2998 CDS 100% 13.200 9.240 N NAALADL2 n/a
4 TRCN0000073962 GACCTCAATCTTGATTCCATT pLKO.1 1298 CDS 100% 4.950 3.465 N NAALADL2 n/a
5 TRCN0000073958 GCCATGTTGAAGAGTGTGTAT pLKO.1 5208 3UTR 100% 4.950 3.465 N NAALADL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017006079.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13460 pDONR223 100% 39.6% 37.6% None (many diffs) n/a
2 ccsbBroad304_13460 pLX_304 0% 39.6% 37.6% V5 (many diffs) n/a
3 TRCN0000474341 GTTCCAGTTGCCGCGCCGGGGTGC pLX_317 42.5% 39.6% 37.6% V5 (many diffs) n/a
Download CSV