Transcript: Human XM_017006098.2

PREDICTED: Homo sapiens armadillo repeat containing 8 (ARMC8), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARMC8 (25852)
Length:
4464
CDS:
287..1981

Additional Resources:

NCBI RefSeq record:
XM_017006098.2
NBCI Gene record:
ARMC8 (25852)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017006098.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000166876 CGGACAGATGATAACTGTATT pLKO.1 968 CDS 100% 13.200 9.240 N ARMC8 n/a
2 TRCN0000319086 CGGACAGATGATAACTGTATT pLKO_005 968 CDS 100% 13.200 9.240 N ARMC8 n/a
3 TRCN0000167599 GAGAATTGTTACCACAGATTT pLKO.1 858 CDS 100% 13.200 9.240 N ARMC8 n/a
4 TRCN0000319013 GAGAATTGTTACCACAGATTT pLKO_005 858 CDS 100% 13.200 9.240 N ARMC8 n/a
5 TRCN0000168419 GTGAAGATGTTACAGAGGGAT pLKO.1 881 CDS 100% 2.640 1.848 N ARMC8 n/a
6 TRCN0000319014 GTGAAGATGTTACAGAGGGAT pLKO_005 881 CDS 100% 2.640 1.848 N ARMC8 n/a
7 TRCN0000167668 GCACTGAAATGTTTCTCAGTT pLKO.1 782 CDS 100% 0.495 0.347 N ARMC8 n/a
8 TRCN0000319084 GCACTGAAATGTTTCTCAGTT pLKO_005 782 CDS 100% 0.495 0.347 N ARMC8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017006098.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02872 pDONR223 100% 42.9% 41.5% None (many diffs) n/a
2 ccsbBroad304_02872 pLX_304 0% 42.9% 41.5% V5 (many diffs) n/a
3 TRCN0000474364 GCAATCAGATGATACCTCGAAGCC pLX_317 45.2% 42.9% 41.5% V5 (many diffs) n/a
Download CSV