Transcript: Human XM_017006272.1

PREDICTED: Homo sapiens glutamate metabotropic receptor 7 (GRM7), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GRM7 (2917)
Length:
5206
CDS:
239..2509

Additional Resources:

NCBI RefSeq record:
XM_017006272.1
NBCI Gene record:
GRM7 (2917)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017006272.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000009034 GCCACTTTCATCCGCTACAAT pLKO.1 1568 CDS 100% 5.625 7.875 N GRM7 n/a
2 TRCN0000242000 TTGCCAACGATGAGGATATAA pLKO_005 597 CDS 100% 15.000 10.500 N Grm7 n/a
3 TRCN0000363191 TTGCCAACGATGAGGATATAA pLKO_005 597 CDS 100% 15.000 10.500 N GRM7 n/a
4 TRCN0000367871 ATCGGATTTATCGCATATTTG pLKO_005 1773 CDS 100% 13.200 9.240 N GRM7 n/a
5 TRCN0000009033 CCTTACTTTATCTGGGCTTAA pLKO.1 2752 3UTR 100% 10.800 7.560 N GRM7 n/a
6 TRCN0000216447 GAATAGAGGTCTTGATCTTTG pLKO.1 3295 3UTR 100% 10.800 7.560 N Grm7 n/a
7 TRCN0000009035 CCAGACTCATAAGCCCAACAT pLKO.1 1821 CDS 100% 4.950 3.465 N GRM7 n/a
8 TRCN0000009037 CCCAGATTAGTTATGCATCAA pLKO.1 264 CDS 100% 4.950 3.465 N GRM7 n/a
9 TRCN0000363160 TACTTTATCTGGGCTTAATAA pLKO_005 2755 3UTR 100% 15.000 9.000 N GRM7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017006272.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489177 TACTAAGGTTGACAGGTACAGTCG pLX_317 12.2% 81.7% 81.3% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000488421 CTTACATAACTAACCGCCTCGATA pLX_317 11.8% 80.2% 79.2% V5 (many diffs) n/a
3 TRCN0000489148 ACCAAGACACGGACTTCTGAAGGA pLX_317 15.8% 80.2% 79.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV