Transcript: Human XM_017006322.1

PREDICTED: Homo sapiens cilia and flagella associated protein 100 (CFAP100), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CFAP100 (348807)
Length:
1702
CDS:
251..1609

Additional Resources:

NCBI RefSeq record:
XM_017006322.1
NBCI Gene record:
CFAP100 (348807)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017006322.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000167389 GAAGCATTACAAGGTCTATAA pLKO.1 1009 CDS 100% 13.200 18.480 N CFAP100 n/a
2 TRCN0000416212 AGCGAACCCTTTCCACTTATC pLKO_005 400 CDS 100% 10.800 15.120 N CFAP100 n/a
3 TRCN0000415632 AGAGATCAGGAGCGGAATAAG pLKO_005 446 CDS 100% 13.200 10.560 N CFAP100 n/a
4 TRCN0000439790 ACGAGTTCGTCAGGGAGAATG pLKO_005 852 CDS 100% 10.800 7.560 N CFAP100 n/a
5 TRCN0000435615 CATTAAGCAGAAGCGGCAAAT pLKO_005 703 CDS 100% 10.800 7.560 N CFAP100 n/a
6 TRCN0000167351 CACCCAGATTGTTAATATCAA pLKO.1 958 CDS 100% 5.625 3.938 N CFAP100 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017006322.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13621 pDONR223 100% 73.8% 49.1% None 416_417insAGC;953_954insAGAGGGTC;1356_1357ins469 n/a
2 ccsbBroad304_13621 pLX_304 0% 73.8% 49.1% V5 416_417insAGC;953_954insAGAGGGTC;1356_1357ins469 n/a
3 TRCN0000479905 CCCTCTTGGAAGACATGCCGCAGG pLX_317 21.6% 73.8% 49.1% V5 416_417insAGC;953_954insAGAGGGTC;1356_1357ins469 n/a
Download CSV