Transcript: Human XM_017006384.2

PREDICTED: Homo sapiens limbic system associated membrane protein (LSAMP), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LSAMP (4045)
Length:
2945
CDS:
233..826

Additional Resources:

NCBI RefSeq record:
XM_017006384.2
NBCI Gene record:
LSAMP (4045)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017006384.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063933 CCGGGATGACACTAGGATAAA pLKO.1 496 CDS 100% 13.200 18.480 N LSAMP n/a
2 TRCN0000415355 GACGACAAGCTTCACTCAAAT pLKO_005 435 CDS 100% 13.200 18.480 N LSAMP n/a
3 TRCN0000420281 AGCCACTTCAGACTATCAATG pLKO_005 1304 3UTR 100% 10.800 8.640 N LSAMP n/a
4 TRCN0000063937 CTGTGAACTATCCTCCCACTA pLKO.1 381 CDS 100% 4.050 2.835 N LSAMP n/a
5 TRCN0000063934 CGGTGAGAGGAATAAATGGAT pLKO.1 738 CDS 100% 3.000 2.100 N LSAMP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017006384.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000472018 TATCCGCCCTAGCGAGGCCAACTT pLX_317 28.1% 47.8% 46.2% V5 (many diffs) n/a
Download CSV