Transcript: Human XM_017006683.1

PREDICTED: Homo sapiens PX domain containing serine/threonine kinase like (PXK), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PXK (54899)
Length:
6796
CDS:
42..1535

Additional Resources:

NCBI RefSeq record:
XM_017006683.1
NBCI Gene record:
PXK (54899)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017006683.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001804 TCCGCAAACTATACTGAGATT pLKO.1 363 CDS 100% 4.950 6.930 N PXK n/a
2 TRCN0000001803 CCACAGTTTAAGATCCCTACA pLKO.1 1209 CDS 100% 4.050 5.670 N PXK n/a
3 TRCN0000342399 CCACAGTTTAAGATCCCTACA pLKO_005 1209 CDS 100% 4.050 5.670 N PXK n/a
4 TRCN0000001801 GTCTAATCAAACTTCTGCCTT pLKO.1 577 CDS 100% 2.640 2.112 N PXK n/a
5 TRCN0000342361 GTCTAATCAAACTTCTGCCTT pLKO_005 577 CDS 100% 2.640 2.112 N PXK n/a
6 TRCN0000001802 ACAGCCACAAACAGTACTATT pLKO.1 6041 3UTR 100% 13.200 9.240 N PXK n/a
7 TRCN0000194925 CGTTGCTAATTAGGATGTTTA pLKO.1 655 CDS 100% 13.200 9.240 N PXK n/a
8 TRCN0000196594 GTACAGCAACTCCAATAATTC pLKO.1 1433 CDS 100% 13.200 9.240 N PXK n/a
9 TRCN0000195613 CGGCTCTTACAGATGCCATTA pLKO.1 1155 CDS 100% 10.800 7.560 N PXK n/a
10 TRCN0000001800 GCCTTCCTTCTACCGATCTTA pLKO.1 929 CDS 100% 5.625 3.938 N PXK n/a
11 TRCN0000342398 GCCTTCCTTCTACCGATCTTA pLKO_005 929 CDS 100% 5.625 3.938 N PXK n/a
12 TRCN0000197047 GCTTCCTGTTTACACTTGGAG pLKO.1 5942 3UTR 100% 2.640 1.848 N PXK n/a
13 TRCN0000199401 CAAACTACCCTCTTCCTGGGA pLKO.1 6001 3UTR 100% 0.660 0.462 N PXK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017006683.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12106 pDONR223 100% 84.1% 84.2% None 101_102ins51;852C>T;1300_1491del n/a
2 ccsbBroad304_12106 pLX_304 0% 84.1% 84.2% V5 101_102ins51;852C>T;1300_1491del n/a
3 TRCN0000471464 CGATAACATCTCGACTATGCAATA pLX_317 35.6% 84.1% 84.2% V5 101_102ins51;852C>T;1300_1491del n/a
4 ccsbBroadEn_15084 pDONR223 0% 84.1% 84.2% None 101_102ins51;852C>T;1300_1491del n/a
5 ccsbBroad304_15084 pLX_304 0% 84.1% 84.2% V5 101_102ins51;852C>T;1300_1491del n/a
6 TRCN0000465367 CCCCCTCCTCTAAACAATTGGTAC pLX_317 14.5% 84.1% 84.2% V5 101_102ins51;852C>T;1300_1491del n/a
Download CSV