Transcript: Human XM_017006784.1

PREDICTED: Homo sapiens SET domain containing 5 (SETD5), transcript variant X28, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SETD5 (55209)
Length:
7188
CDS:
4170..7097

Additional Resources:

NCBI RefSeq record:
XM_017006784.1
NBCI Gene record:
SETD5 (55209)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017006784.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098704 CCCAAACACTACATTCGCTTT pLKO.1 6540 CDS 100% 4.050 5.670 N Setd5 n/a
2 TRCN0000253863 AGACTTGTTGAGCCCATTAAA pLKO_005 6761 CDS 100% 15.000 10.500 N SETD5 n/a
3 TRCN0000253862 CAACCGTGCTGCATCTAAATA pLKO_005 6353 CDS 100% 15.000 10.500 N SETD5 n/a
4 TRCN0000253861 AGCGTGTATTCCACTCATAAT pLKO_005 4302 CDS 100% 13.200 9.240 N SETD5 n/a
5 TRCN0000253860 TTGTGGGCAAACCTACTATTT pLKO_005 5014 CDS 100% 13.200 9.240 N SETD5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017006784.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12183 pDONR223 100% 27.6% 26.9% None (many diffs) n/a
2 ccsbBroad304_12183 pLX_304 0% 27.6% 26.9% V5 (many diffs) n/a
3 TRCN0000471018 TCACCTGCGTAGGGTTCCCTTGAC pLX_317 15.3% 27.6% 26.9% V5 (many diffs) n/a
Download CSV