Transcript: Human XM_017006871.1

PREDICTED: Homo sapiens mannan binding lectin serine peptidase 1 (MASP1), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MASP1 (5648)
Length:
2954
CDS:
364..2346

Additional Resources:

NCBI RefSeq record:
XM_017006871.1
NBCI Gene record:
MASP1 (5648)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017006871.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419636 TGGGTTTCGGATCAAGCTTTA pLKO_005 546 CDS 100% 10.800 15.120 N MASP1 n/a
2 TRCN0000046619 CCAGTGATTCAGAGGTGACTT pLKO.1 506 CDS 100% 4.950 3.465 N MASP1 n/a
3 TRCN0000046621 CCATCACTTTCCGGTCAGATT pLKO.1 728 CDS 100% 4.950 3.465 N MASP1 n/a
4 TRCN0000046618 GCCCTATTACAAGATGCTCAA pLKO.1 1581 CDS 100% 4.050 2.835 N MASP1 n/a
5 TRCN0000046620 GCTGAAGGATAATGTGGAGAT pLKO.1 1389 CDS 100% 4.050 2.835 N MASP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017006871.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06786 pDONR223 100% 75.7% 68.6% None (many diffs) n/a
2 ccsbBroad304_06786 pLX_304 0% 75.7% 68.6% V5 (many diffs) n/a
3 TRCN0000474736 GAAGCAAGCTATATACGATGATGT pLX_317 17.3% 75.7% 68.6% V5 (many diffs) n/a
Download CSV