Transcript: Human XM_017007062.1

PREDICTED: Homo sapiens fibronectin type III domain containing 3B (FNDC3B), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FNDC3B (64778)
Length:
6707
CDS:
153..3485

Additional Resources:

NCBI RefSeq record:
XM_017007062.1
NBCI Gene record:
FNDC3B (64778)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017007062.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000082777 GCCATCATTGTGCTTGGCTTT pLKO.1 3411 CDS 100% 4.050 5.670 N FNDC3B n/a
2 TRCN0000082773 CCCTAATTGAATGTGTTTGAA pLKO.1 6416 3UTR 100% 5.625 4.500 N FNDC3B n/a
3 TRCN0000082774 CGGATCTGAAATCCTTGCTTA pLKO.1 2558 CDS 100% 4.950 3.960 N FNDC3B n/a
4 TRCN0000082775 CGTGCAATAACGGATCTGAAA pLKO.1 2548 CDS 100% 4.950 3.960 N FNDC3B n/a
5 TRCN0000229811 ATGCAGCTCAGCAGGTTATTC pLKO_005 250 CDS 100% 13.200 9.240 N FNDC3B n/a
6 TRCN0000229812 CATGTGCCTCCAGGTTATATC pLKO_005 390 CDS 100% 13.200 9.240 N FNDC3B n/a
7 TRCN0000229814 GGACAGAAACAAGAGGTTTAT pLKO_005 2864 CDS 100% 13.200 9.240 N FNDC3B n/a
8 TRCN0000218262 GTGTTACTCTTACGTGTTTAT pLKO_005 4842 3UTR 100% 13.200 9.240 N FNDC3B n/a
9 TRCN0000382174 TGCCATGTACAATTCCGTAAA pLKO_005 938 CDS 100% 10.800 7.560 N FNDC3B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017007062.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12489 pDONR223 100% 5.6% 5.4% None (many diffs) n/a
2 ccsbBroad304_12489 pLX_304 0% 5.6% 5.4% V5 (many diffs) n/a
3 TRCN0000473998 CTTAAATCGATCTACCCCACAGTC pLX_317 100% 5.6% 5.4% V5 (many diffs) n/a
Download CSV