Transcript: Human XM_017007077.1

PREDICTED: Homo sapiens solute carrier organic anion transporter family member 2A1 (SLCO2A1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLCO2A1 (6578)
Length:
3350
CDS:
767..2194

Additional Resources:

NCBI RefSeq record:
XM_017007077.1
NBCI Gene record:
SLCO2A1 (6578)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017007077.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000043067 GTGGATTTCATTAAACGGTTT pLKO.1 1187 CDS 100% 4.050 5.670 N SLCO2A1 n/a
2 TRCN0000043064 CCTCCAAGCAACTGATCTATT pLKO.1 1710 CDS 100% 13.200 10.560 N SLCO2A1 n/a
3 TRCN0000425823 CTGTACATCTCCATCTTATTT pLKO_005 878 CDS 100% 15.000 10.500 N SLCO2A1 n/a
4 TRCN0000438303 CATCGGGACAGTGCCTATTCA pLKO_005 805 CDS 100% 5.625 3.938 N SLCO2A1 n/a
5 TRCN0000043063 CCCTAGCACATCAAGTTCTAT pLKO.1 1552 CDS 100% 5.625 3.938 N SLCO2A1 n/a
6 TRCN0000043066 CAGTTCTTCATCGGGTCTCAT pLKO.1 460 5UTR 100% 4.950 3.465 N SLCO2A1 n/a
7 TRCN0000043065 CCTGCTCATTTCTTCAGCTTT pLKO.1 1042 CDS 100% 4.950 3.465 N SLCO2A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017007077.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01552 pDONR223 100% 73.8% 73.8% None 0_1ins504 n/a
2 ccsbBroad304_01552 pLX_304 0% 73.8% 73.8% V5 0_1ins504 n/a
3 TRCN0000479346 GCACATAGCTTGCCCCGAACTAGC pLX_317 22.6% 73.8% 73.8% V5 0_1ins504 n/a
Download CSV