Transcript: Human XM_017007277.1

PREDICTED: Homo sapiens centrosomal protein 70 (CEP70), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CEP70 (80321)
Length:
2187
CDS:
216..1658

Additional Resources:

NCBI RefSeq record:
XM_017007277.1
NBCI Gene record:
CEP70 (80321)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017007277.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415299 TTCATACACAAAGGCAATATA pLKO_005 439 CDS 100% 15.000 21.000 N CEP70 n/a
2 TRCN0000431645 TCAAATTACAGGAGCTTATTA pLKO_005 700 CDS 100% 15.000 10.500 N CEP70 n/a
3 TRCN0000142362 GAGCAGGTTATGCAGGTATTA pLKO.1 1371 CDS 100% 13.200 9.240 N CEP70 n/a
4 TRCN0000422712 GGTGCTGTGTAGCATCAATTC pLKO_005 809 CDS 100% 10.800 7.560 N CEP70 n/a
5 TRCN0000423281 TAATTGACCAGAGATACTTTC pLKO_005 787 CDS 100% 10.800 7.560 N CEP70 n/a
6 TRCN0000142363 GAACGGAGCAAGAAGAAACTA pLKO.1 253 CDS 100% 5.625 3.938 N CEP70 n/a
7 TRCN0000141989 GACAGCAATATGCCACACTTT pLKO.1 1128 CDS 100% 4.950 3.465 N CEP70 n/a
8 TRCN0000121863 GCAGATCAACTGACATCCTTA pLKO.1 957 CDS 100% 4.950 3.465 N CEP70 n/a
9 TRCN0000145474 GCCTTCTTTAAATGGAGTCTA pLKO.1 1196 CDS 100% 4.950 3.465 N CEP70 n/a
10 TRCN0000141829 GCTAGTAAGCACTGTTGGAAA pLKO.1 1319 CDS 100% 4.950 3.465 N CEP70 n/a
11 TRCN0000145182 GCTTAATTTGAAGAAGCAGGA pLKO.1 1028 CDS 100% 2.160 1.512 N CEP70 n/a
12 TRCN0000142143 GAAGATGTGAATGAGCAGGTT pLKO.1 1359 CDS 100% 2.640 1.584 N CEP70 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017007277.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09028 pDONR223 100% 69.2% 67.2% None (many diffs) n/a
2 ccsbBroad304_09028 pLX_304 0% 69.2% 67.2% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000467975 AAATTTTCATGCAATATTGAGCCA pLX_317 23.2% 69.2% 67.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV