Transcript: Human XM_017007420.2

PREDICTED: Homo sapiens succinate-CoA ligase GDP-forming beta subunit (SUCLG2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SUCLG2 (8801)
Length:
2995
CDS:
26..1252

Additional Resources:

NCBI RefSeq record:
XM_017007420.2
NBCI Gene record:
SUCLG2 (8801)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017007420.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000048505 GCCAGGCTGCAGATCAAATTA pLKO.1 681 CDS 100% 15.000 10.500 N SUCLG2 n/a
2 TRCN0000235573 CTCCCAGAATCTACCAGTTTA pLKO_005 2822 3UTR 100% 13.200 9.240 N SUCLG2 n/a
3 TRCN0000244308 CTGAACATATTAGCTACTAAA pLKO_005 2421 3UTR 100% 13.200 9.240 N SUCLG2 n/a
4 TRCN0000235572 ATTGTGTTTAGTATCACTATC pLKO_005 2770 3UTR 100% 10.800 7.560 N SUCLG2 n/a
5 TRCN0000235575 TGGCTGAACCTGCAGGAATAC pLKO_005 134 CDS 100% 10.800 7.560 N SUCLG2 n/a
6 TRCN0000048506 AGGTGTCTTCAATAGTGGTTT pLKO.1 304 CDS 100% 4.950 3.465 N SUCLG2 n/a
7 TRCN0000048507 CCAGCCAACTTCTTGGATCTT pLKO.1 1004 CDS 100% 4.950 3.465 N SUCLG2 n/a
8 TRCN0000048504 GCCTTGGATATTTCCAGAGAA pLKO.1 458 CDS 100% 4.950 3.465 N SUCLG2 n/a
9 TRCN0000048547 GCTGTATAATCTCTTCCTGAA pLKO.1 706 CDS 100% 4.050 2.835 N SUCLG2P2 n/a
10 TRCN0000048503 CCTGCTTCATTTACAAGAATT pLKO.1 2294 3UTR 100% 0.000 0.000 N SUCLG2 n/a
11 TRCN0000235574 CAACGGAGTGAGAGTTCAAAG pLKO_005 178 CDS 100% 10.800 6.480 N SUCLG2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017007420.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11305 pDONR223 100% 81.6% 80.6% None (many diffs) n/a
2 ccsbBroad304_11305 pLX_304 0% 81.6% 80.6% V5 (many diffs) n/a
3 TRCN0000480412 ACAAGATCCAATTGACGCAGGTAT pLX_317 26.2% 81.6% 80.6% V5 (many diffs) n/a
Download CSV