Transcript: Human XM_017007653.1

PREDICTED: Homo sapiens transforming acidic coiled-coil containing protein 3 (TACC3), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TACC3 (10460)
Length:
2882
CDS:
208..2724

Additional Resources:

NCBI RefSeq record:
XM_017007653.1
NBCI Gene record:
TACC3 (10460)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017007653.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296701 GTTTGGAACTTCCTCGTTTAA pLKO_005 1836 CDS 100% 13.200 18.480 N TACC3 n/a
2 TRCN0000312811 GTTTGGAACTTCCTCGTTTAA pLKO_005 1836 CDS 100% 13.200 18.480 N Tacc3 n/a
3 TRCN0000062026 GCTTGTGGAGTTCGATTTCTT pLKO.1 2004 CDS 100% 5.625 7.875 N TACC3 n/a
4 TRCN0000290485 GCTTGTGGAGTTCGATTTCTT pLKO_005 2004 CDS 100% 5.625 7.875 N TACC3 n/a
5 TRCN0000360142 ACAGACGCACAGGATTCTAAG pLKO_005 399 CDS 100% 10.800 8.640 N TACC3 n/a
6 TRCN0000308273 AGCAGCATGCACGGTGCAAAT pLKO_005 1951 CDS 100% 10.800 8.640 N TACC3 n/a
7 TRCN0000296700 TGAAATCCAGAAAGTTCTAAA pLKO_005 2304 CDS 100% 13.200 9.240 N TACC3 n/a
8 TRCN0000360084 TTGAGGAAGCAGTCCTTATAC pLKO_005 1867 CDS 100% 13.200 9.240 N TACC3 n/a
9 TRCN0000062024 GCAGTCCTTATACCTCAAGTT pLKO.1 1875 CDS 100% 4.950 3.465 N TACC3 n/a
10 TRCN0000062027 CCAGGAAGTTCTGAGAACCAA pLKO.1 688 CDS 100% 3.000 2.100 N TACC3 n/a
11 TRCN0000062025 CGCACAGGATTCTAAGTCCTA pLKO.1 404 CDS 100% 2.640 1.848 N TACC3 n/a
12 TRCN0000360098 AGAAGTGGCTGCAGGCCAAAT pLKO_005 1167 CDS 100% 10.800 6.480 N TACC3 n/a
13 TRCN0000062023 CCACGGAGCCGCTGTCCCCGC pLKO.1 2728 3UTR 100% 0.000 0.000 N TACC3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017007653.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14047 pDONR223 100% 99.9% 99.7% None 1689C>T;2508delG n/a
2 ccsbBroad304_14047 pLX_304 0% 99.9% 99.7% V5 (not translated due to frame shift) 1689C>T;2508delG n/a
3 TRCN0000476865 GGCAGTACACACTTCACTTACACA pLX_317 14.1% 99.9% 99.7% V5 (not translated due to frame shift) 1689C>T;2508delG n/a
4 ccsbBroadEn_07612 pDONR223 100% 99.8% 99.6% None (many diffs) n/a
5 ccsbBroad304_07612 pLX_304 0% 99.8% 99.6% V5 (many diffs) n/a
6 TRCN0000492206 CCCTCAGAAGCCGCAAACAAGACC pLX_317 7.9% 99.8% 99.6% V5 (many diffs) n/a
Download CSV