Transcript: Human XM_017007765.2

PREDICTED: Homo sapiens C-terminal binding protein 1 (CTBP1), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CTBP1 (1487)
Length:
2343
CDS:
258..1547

Additional Resources:

NCBI RefSeq record:
XM_017007765.2
NBCI Gene record:
CTBP1 (1487)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017007765.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000013739 ACCGTCAAGCAGATGAGACAA pLKO.1 975 CDS 100% 4.950 6.930 N CTBP1 n/a
2 TRCN0000273844 ACCGTCAAGCAGATGAGACAA pLKO_005 975 CDS 100% 4.950 6.930 N CTBP1 n/a
3 TRCN0000013740 CGAGCAGGCATCCATCGAGAT pLKO.1 1184 CDS 100% 1.350 1.890 N CTBP1 n/a
4 TRCN0000013738 GCAGAAGAAGTCAGTAGTTAT pLKO.1 1762 3UTR 100% 13.200 10.560 N CTBP1 n/a
5 TRCN0000285086 GCAGAAGAAGTCAGTAGTTAT pLKO_005 1762 3UTR 100% 13.200 10.560 N CTBP1 n/a
6 TRCN0000273905 AGTCGGAACCCTTCAGCTTTA pLKO_005 1102 CDS 100% 10.800 7.560 N CTBP1 n/a
7 TRCN0000013742 CCACGCCAGTGACCAGTTGTA pLKO.1 1526 CDS 100% 1.650 1.155 N CTBP1 n/a
8 TRCN0000273842 CCACGCCAGTGACCAGTTGTA pLKO_005 1526 CDS 100% 1.650 1.155 N CTBP1 n/a
9 TRCN0000013741 CTCCGCATCATCGTCCGGATT pLKO.1 498 CDS 100% 1.350 0.945 N CTBP1 n/a
10 TRCN0000273843 TTTGACAACATCGACATCAAG pLKO_005 528 CDS 100% 4.950 2.970 N CTBP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017007765.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00389 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00389 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474981 CGCGTGTTGCTTGACGGCCTAACC pLX_317 16.5% 100% 100% V5 n/a
Download CSV