Transcript: Human XM_017007813.1

PREDICTED: Homo sapiens RasGEF domain family member 1B (RASGEF1B), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RASGEF1B (153020)
Length:
3050
CDS:
254..1675

Additional Resources:

NCBI RefSeq record:
XM_017007813.1
NBCI Gene record:
RASGEF1B (153020)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017007813.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000077695 GCCAAACAAGTGAGTGAATTT pLKO.1 1469 CDS 100% 13.200 9.240 N Rasgef1b n/a
2 TRCN0000072966 GCTCTCTACTTGGCTTCTTAT pLKO.1 1577 CDS 100% 13.200 9.240 N RASGEF1B n/a
3 TRCN0000072964 CGGAAACATTTCCCTATGATT pLKO.1 606 CDS 100% 5.625 3.938 N RASGEF1B n/a
4 TRCN0000072967 GAAGCACTCATCCAGCACTTA pLKO.1 383 CDS 100% 4.950 3.465 N RASGEF1B n/a
5 TRCN0000072965 CGGTTATTTATGCATCCGTAT pLKO.1 464 CDS 100% 4.050 2.835 N RASGEF1B n/a
6 TRCN0000072963 GCTGACAGATAGACTCAGATT pLKO.1 1855 3UTR 100% 4.950 2.970 N RASGEF1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017007813.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13290 pDONR223 100% 99.7% 99.7% None 437_439delAGC n/a
2 ccsbBroad304_13290 pLX_304 0% 99.7% 99.7% V5 437_439delAGC n/a
3 TRCN0000467494 GTTCTTGGTGCAGCTCGATGCTAT pLX_317 30.5% 99.7% 99.7% V5 437_439delAGC n/a
Download CSV