Transcript: Human XM_017007877.1

PREDICTED: Homo sapiens glutamyl aminopeptidase (ENPEP), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ENPEP (2028)
Length:
2631
CDS:
95..1894

Additional Resources:

NCBI RefSeq record:
XM_017007877.1
NBCI Gene record:
ENPEP (2028)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017007877.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412757 ATGTCTTCGCATCCAATTATT pLKO_005 383 CDS 100% 15.000 21.000 N ENPEP n/a
2 TRCN0000051687 GCTCAAGGACACGAACCTTAT pLKO.1 1534 CDS 100% 10.800 15.120 N ENPEP n/a
3 TRCN0000414935 ACTGTAAGCCTTCCCGTAAAT pLKO_005 1343 CDS 100% 13.200 10.560 N ENPEP n/a
4 TRCN0000434548 GAACAATGCTTCCTCGTTATT pLKO_005 1303 CDS 100% 13.200 10.560 N ENPEP n/a
5 TRCN0000051686 GCTACCAGTGAAAGAAGTAAT pLKO.1 604 CDS 100% 13.200 9.240 N ENPEP n/a
6 TRCN0000434002 GTCATTCGATATATCTCATAT pLKO_005 1577 CDS 100% 13.200 9.240 N ENPEP n/a
7 TRCN0000051684 GCTTTGAACTTGACCAAGTAT pLKO.1 1046 CDS 100% 5.625 3.375 N ENPEP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017007877.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06163 pDONR223 100% 62.5% 62.5% None 0_1ins1074 n/a
2 ccsbBroad304_06163 pLX_304 0% 62.5% 62.5% V5 0_1ins1074 n/a
3 TRCN0000476019 TGCTCGTCATGAAACGAGGGTATC pLX_317 12.2% 62.5% 62.5% V5 0_1ins1074 n/a
Download CSV