Transcript: Human XM_017007880.2

PREDICTED: Homo sapiens EPH receptor A5 (EPHA5), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EPHA5 (2044)
Length:
7245
CDS:
194..2752

Additional Resources:

NCBI RefSeq record:
XM_017007880.2
NBCI Gene record:
EPHA5 (2044)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001149265 TAGAACTCAAATTTACCCTG pXPR_003 CGG 399 16% 3 0.3395 EPHA5 EPHA5 76677
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017007880.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230102 AGAGACCAGCTACACGATTAT pLKO_005 1234 CDS 100% 13.200 18.480 N EPHA5 n/a
2 TRCN0000230104 ATCAAGCTGTCCACGAATTTG pLKO_005 1617 CDS 100% 13.200 18.480 N EPHA5 n/a
3 TRCN0000195490 CCCTTAAAGTAGGCTATACTG pLKO.1 1761 CDS 100% 4.950 6.930 N EPHA5 n/a
4 TRCN0000023325 CCTACAGATCAGTAGGTGAAT pLKO.1 2535 CDS 100% 0.495 0.693 N Epha5 n/a
5 TRCN0000194728 CCTGTAAGGAAACCTTTAATA pLKO.1 630 CDS 100% 15.000 10.500 N EPHA5 n/a
6 TRCN0000230101 TCTGTGCGTGTATACTATAAA pLKO_005 866 CDS 100% 15.000 10.500 N EPHA5 n/a
7 TRCN0000355757 CTGTGACAGTGGGAGTCATTT pLKO_005 1437 CDS 100% 13.200 9.240 N EPHA5 n/a
8 TRCN0000006415 GCTGGCAGAAAGAGCGAAATA pLKO.1 2379 CDS 100% 13.200 9.240 N EPHA5 n/a
9 TRCN0000355756 TGATCTTGGTGACCGTGTTAT pLKO_005 751 CDS 100% 13.200 9.240 N EPHA5 n/a
10 TRCN0000355755 TATCCACACATACCAAGTATG pLKO_005 478 CDS 100% 10.800 7.560 N EPHA5 n/a
11 TRCN0000195289 CGAAGTGAATTTATTGGATTC pLKO.1 370 CDS 100% 6.000 4.200 N EPHA5 n/a
12 TRCN0000196845 GCAATAGCTTTCCGAAAGTTT pLKO.1 2183 CDS 100% 5.625 3.938 N EPHA5 n/a
13 TRCN0000006413 TGAATGATTCTGCACTTTGTA pLKO.1 2779 3UTR 100% 5.625 3.938 N EPHA5 n/a
14 TRCN0000194954 CATGTAAATGTCGCTTCTTCA pLKO.1 2756 3UTR 100% 4.950 3.465 N EPHA5 n/a
15 TRCN0000195067 CAAGTGAATGATTCTGCACTT pLKO.1 2775 3UTR 100% 0.405 0.284 N EPHA5 n/a
16 TRCN0000355758 CATCCTAACATCATCCATTTA pLKO_005 1835 CDS 100% 13.200 7.920 N EPHA5 n/a
17 TRCN0000368339 GCATCCTGCAGAGTATCTAAT pLKO_005 2480 CDS 100% 13.200 7.920 N EPHA5 n/a
18 TRCN0000006416 GCCAGGAGTAAGAACTTACAT pLKO.1 1570 CDS 100% 5.625 3.375 N EPHA5 n/a
19 TRCN0000218172 CTTCATGTAAATGTCGCTTCT pLKO_005 2753 CDS 100% 4.050 2.430 N EPHA5 n/a
20 TRCN0000194901 CCAATCAAGATGTGATTAAAG pLKO.1 2286 CDS 100% 1.320 0.660 Y EPHA4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017007880.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488924 GGGCAGAAACGGTTTTATAGGCCT pLX_317 29.1% 49.1% .7% V5 (not translated due to prior stop codon) 1_1298del;1300A>T n/a
Download CSV