Transcript: Human XM_017007900.1

PREDICTED: Homo sapiens LIM and calponin homology domains 1 (LIMCH1), transcript variant X22, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LIMCH1 (22998)
Length:
6092
CDS:
57..3233

Additional Resources:

NCBI RefSeq record:
XM_017007900.1
NBCI Gene record:
LIMCH1 (22998)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017007900.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000153799 CGGATCACTCACCATTTCTTT pLKO.1 3251 3UTR 100% 5.625 7.875 N LIMCH1 n/a
2 TRCN0000344249 CGGATCACTCACCATTTCTTT pLKO_005 3251 3UTR 100% 5.625 7.875 N LIMCH1 n/a
3 TRCN0000152971 GCACCGAGATAAGTTCATCAT pLKO.1 4153 3UTR 100% 4.950 6.930 N LIMCH1 n/a
4 TRCN0000152052 CCTGAACTGTAATGATTGCTA pLKO.1 3173 CDS 100% 3.000 4.200 N LIMCH1 n/a
5 TRCN0000155729 CCATTGCAGGACTGGACAATA pLKO.1 280 CDS 100% 13.200 10.560 N LIMCH1 n/a
6 TRCN0000153744 CGAGACCCTCAATCTCTATTT pLKO.1 3065 CDS 100% 13.200 9.240 N LIMCH1 n/a
7 TRCN0000344328 CGAGACCCTCAATCTCTATTT pLKO_005 3065 CDS 100% 13.200 9.240 N LIMCH1 n/a
8 TRCN0000153260 GCCATTCAACAGAGCCAAATT pLKO.1 1462 CDS 100% 13.200 9.240 N LIMCH1 n/a
9 TRCN0000344247 GCCATTCAACAGAGCCAAATT pLKO_005 1462 CDS 100% 13.200 9.240 N LIMCH1 n/a
10 TRCN0000156206 CGGTAGCATCGAGATCAACAT pLKO.1 1883 CDS 100% 4.950 3.465 N LIMCH1 n/a
11 TRCN0000154578 GCAGTGAGAAGTCACCTGTTA pLKO.1 2311 CDS 100% 4.950 3.465 N LIMCH1 n/a
12 TRCN0000155165 GCCACTGTTGAAACCACCATT pLKO.1 1557 CDS 100% 4.950 3.465 N LIMCH1 n/a
13 TRCN0000344327 GCCACTGTTGAAACCACCATT pLKO_005 1557 CDS 100% 4.950 3.465 N LIMCH1 n/a
14 TRCN0000153567 GCCCACTTCAATGAATACCTA pLKO.1 4340 3UTR 100% 3.000 2.100 N LIMCH1 n/a
15 TRCN0000154280 GAGAGCTGCATGAAGCATATA pLKO.1 1327 CDS 100% 13.200 7.920 N LIMCH1 n/a
16 TRCN0000344325 GAGAGCTGCATGAAGCATATA pLKO_005 1327 CDS 100% 13.200 7.920 N LIMCH1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017007900.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11657 pDONR223 100% 14.9% 14.3% None (many diffs) n/a
2 ccsbBroad304_11657 pLX_304 0% 14.9% 14.3% V5 (many diffs) n/a
3 TRCN0000469060 CAGATCAGGCACCAGCCCCTGCAA pLX_317 60% 14.9% 14.3% V5 (many diffs) n/a
Download CSV