Transcript: Human XM_017008049.2

PREDICTED: Homo sapiens sperm tail PG-rich repeat containing 2 (STPG2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
STPG2 (285555)
Length:
3447
CDS:
337..1836

Additional Resources:

NCBI RefSeq record:
XM_017008049.2
NBCI Gene record:
STPG2 (285555)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017008049.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263860 TACCTAACTTGACTAACAAAT pLKO_005 1352 CDS 100% 0.000 0.000 N STPG2 n/a
2 TRCN0000172325 CGACAGGTAGTAATGCACCAT pLKO.1 440 CDS 100% 2.640 2.112 N STPG2 n/a
3 TRCN0000263861 CCAGGTCCAGGACACTATAAT pLKO_005 523 CDS 100% 15.000 10.500 N STPG2 n/a
4 TRCN0000282839 CCGGCTCCTGGCACATATAAT pLKO_005 1018 CDS 100% 15.000 10.500 N STPG2 n/a
5 TRCN0000166990 CCTGCTGATTATCAGGAATTT pLKO.1 1297 CDS 100% 13.200 9.240 N STPG2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017008049.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05401 pDONR223 100% 74.5% 69.9% None (many diffs) n/a
2 ccsbBroad304_05401 pLX_304 0% 74.5% 69.9% V5 (many diffs) n/a
3 TRCN0000466637 TTCTCTAACACGTACCTTCCAATA pLX_317 30.4% 74.5% 69.9% V5 (many diffs) n/a
Download CSV