Transcript: Human XM_017008171.2

PREDICTED: Homo sapiens recombination signal binding protein for immunoglobulin kappa J region (RBPJ), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RBPJ (3516)
Length:
1725
CDS:
16..1521

Additional Resources:

NCBI RefSeq record:
XM_017008171.2
NBCI Gene record:
RBPJ (3516)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017008171.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000016204 CCCTAACGAATCAAACACAAA pLKO.1 1425 CDS 100% 4.950 6.930 N RBPJ n/a
2 TRCN0000305837 TAGGGAAGCTATGCGAAATTA pLKO_005 114 CDS 100% 15.000 12.000 N Rbpj n/a
3 TRCN0000421507 GCATGTAGAAGGAGGTAATTT pLKO_005 627 CDS 100% 15.000 10.500 N RBPJ n/a
4 TRCN0000016205 GCACAGATAAGGCAGAGTATA pLKO.1 1013 CDS 100% 13.200 9.240 N RBPJ n/a
5 TRCN0000016207 CCAGACAGTTAGTACCAGATA pLKO.1 603 CDS 100% 4.950 3.465 N RBPJ n/a
6 TRCN0000016206 GCAGCTAAACTTGGAAGGAAA pLKO.1 357 CDS 100% 4.950 3.465 N RBPJ n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017008171.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06435 pDONR223 100% 95.8% 96% None (many diffs) n/a
2 ccsbBroad304_06435 pLX_304 38.7% 95.8% 96% V5 (many diffs) n/a
3 TRCN0000470066 CCAATAGATCCTTCAAGCAGAACC pLX_317 29.2% 95.8% 96% V5 (many diffs) n/a
Download CSV