Transcript: Human XM_017008183.1

PREDICTED: Homo sapiens kallikrein B1 (KLKB1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KLKB1 (3818)
Length:
2110
CDS:
72..1730

Additional Resources:

NCBI RefSeq record:
XM_017008183.1
NBCI Gene record:
KLKB1 (3818)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017008183.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422214 AGGATGTTTGGCGCATCTATA pLKO_005 1396 CDS 100% 13.200 10.560 N KLKB1 n/a
2 TRCN0000050640 GCTTCTTGAAAGATAGTGTTA pLKO.1 301 CDS 100% 4.950 3.960 N KLKB1 n/a
3 TRCN0000412744 ACCGGAACAATTGCCTATTAA pLKO_005 556 CDS 100% 15.000 10.500 N KLKB1 n/a
4 TRCN0000412526 ATACACCTTTCTCACAAATAA pLKO_005 1450 CDS 100% 15.000 10.500 N KLKB1 n/a
5 TRCN0000050642 GCCTCTTCTTTACATTCTATA pLKO.1 781 CDS 100% 13.200 9.240 N KLKB1 n/a
6 TRCN0000415545 GTGCTTGCCATCGAGACATTT pLKO_005 397 CDS 100% 13.200 9.240 N KLKB1 n/a
7 TRCN0000050641 CCGCTATAAAGGTGCTGAGTA pLKO.1 601 CDS 100% 4.950 3.465 N KLKB1 n/a
8 TRCN0000050638 GCTGAGTACATGGACTGGATT pLKO.1 1774 3UTR 100% 4.950 3.465 N KLKB1 n/a
9 TRCN0000050639 GCAGTGTTGAAGAATGCCAAA pLKO.1 466 CDS 100% 4.050 2.835 N KLKB1 n/a
10 TRCN0000431578 CAACCTGAGTTCAAGTCAAAT pLKO_005 1878 3UTR 100% 13.200 7.920 N KLKB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017008183.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06493 pDONR223 100% 86.4% 82.5% None 428G>A;1582_1583ins140;1656_1657ins118 n/a
2 ccsbBroad304_06493 pLX_304 0% 86.4% 82.5% V5 428G>A;1582_1583ins140;1656_1657ins118 n/a
3 TRCN0000472800 CCAGACGATTGTAAGTCAATAGAT pLX_317 21.9% 86.4% 82.5% V5 428G>A;1582_1583ins140;1656_1657ins118 n/a
4 ccsbBroadEn_06492 pDONR223 100% 86.4% 82.5% None (many diffs) n/a
5 ccsbBroad304_06492 pLX_304 0% 86.4% 82.5% V5 (many diffs) n/a
6 TRCN0000474227 TACTGTATTCCGACACTGACTGTC pLX_317 19.1% 86.4% 82.5% V5 (many diffs) n/a
Download CSV