Transcript: Human XM_017008214.1

PREDICTED: Homo sapiens microsomal glutathione S-transferase 2 (MGST2), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MGST2 (4258)
Length:
1179
CDS:
144..383

Additional Resources:

NCBI RefSeq record:
XM_017008214.1
NBCI Gene record:
MGST2 (4258)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017008214.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000152420 CATATATGGCCGTCACCTATA pLKO.1 197 CDS 100% 10.800 15.120 N MGST2 n/a
2 TRCN0000278432 CATATATGGCCGTCACCTATA pLKO_005 197 CDS 100% 10.800 15.120 N MGST2 n/a
3 TRCN0000150912 GATGAATATCTGGACCTCAAT pLKO.1 333 CDS 100% 4.950 3.465 N MGST2 n/a
4 TRCN0000297455 GATGAATATCTGGACCTCAAT pLKO_005 333 CDS 100% 4.950 3.465 N MGST2 n/a
5 TRCN0000152898 GCAAACAGCTTTCTGGATGAA pLKO.1 318 CDS 100% 4.950 3.465 N MGST2 n/a
6 TRCN0000155842 CCTGGGAATTGCAAACAGCTT pLKO.1 308 CDS 100% 2.640 1.848 N MGST2 n/a
7 TRCN0000352900 CCTGGGAATTGCAAACAGCTT pLKO_005 308 CDS 100% 2.640 1.848 N MGST2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017008214.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01010 pDONR223 100% 53.7% 53.7% None 0_1ins204 n/a
2 ccsbBroad304_01010 pLX_304 0% 53.7% 53.7% V5 0_1ins204 n/a
3 TRCN0000480569 AACCCTTTCACATTTGCCTTCATC pLX_317 81.1% 53.7% 53.7% V5 0_1ins204 n/a
Download CSV