Transcript: Human XM_017008416.1

PREDICTED: Homo sapiens protein kinase cGMP-dependent 2 (PRKG2), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PRKG2 (5593)
Length:
4223
CDS:
550..2874

Additional Resources:

NCBI RefSeq record:
XM_017008416.1
NBCI Gene record:
PRKG2 (5593)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017008416.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434260 ATGCTGAGGGTTACCTTAAAT pLKO_005 2303 CDS 100% 15.000 21.000 N PRKG2 n/a
2 TRCN0000422969 TGATCAACCACAGCTGATAAA pLKO_005 1569 CDS 100% 13.200 18.480 N PRKG2 n/a
3 TRCN0000429257 ACCAAACTGTCGGTACATTTG pLKO_005 1712 CDS 100% 10.800 15.120 N PRKG2 n/a
4 TRCN0000196975 GCACTAGATCGAGAGGTATTC pLKO.1 1315 CDS 100% 10.800 15.120 N PRKG2 n/a
5 TRCN0000194661 CAAAGGAGATTACATCATTAG pLKO.1 1473 CDS 100% 10.800 7.560 N PRKG2 n/a
6 TRCN0000197044 GCTCATTACAGATGCCCTTAA pLKO.1 1020 CDS 100% 10.800 7.560 N PRKG2 n/a
7 TRCN0000197105 GCTTGGAAGTGGAATACTATG pLKO.1 1451 CDS 100% 10.800 7.560 N PRKG2 n/a
8 TRCN0000430641 TCCCTATGTGGACCACATTTG pLKO_005 1223 CDS 100% 10.800 7.560 N PRKG2 n/a
9 TRCN0000426050 TGGATCCTCAGCAGATCAAAG pLKO_005 1064 CDS 100% 10.800 7.560 N PRKG2 n/a
10 TRCN0000001509 CCCAAGCTAGAGATGAACAAT pLKO.1 1358 CDS 100% 5.625 3.938 N PRKG2 n/a
11 TRCN0000001511 GACCAAATGATGACCTACAAT pLKO.1 2509 CDS 100% 5.625 3.938 N PRKG2 n/a
12 TRCN0000001510 GCAAACCTGAACCGTGATGAT pLKO.1 1765 CDS 100% 4.950 3.465 N PRKG2 n/a
13 TRCN0000001508 GCCTGGTTATAGATCGAGAAA pLKO.1 1685 CDS 100% 4.950 3.465 N PRKG2 n/a
14 TRCN0000425669 ATGTCAGGTCAGCTAACATTA pLKO_005 1640 CDS 100% 13.200 7.920 N PRKG2 n/a
15 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 3641 3UTR 100% 4.950 2.475 Y ORAI2 n/a
16 TRCN0000138391 CGCCTGTAATCCTAGCACTTT pLKO.1 3565 3UTR 100% 4.950 2.475 Y DENND6A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017008416.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14798 pDONR223 70.9% 95% 30.7% None (many diffs) n/a
2 ccsbBroad304_14798 pLX_304 0% 95% 30.7% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000474788 GTGGCTATCTTTATGGTCCATATC pLX_317 19.2% 95% 30.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV