Transcript: Human XM_017008484.2

PREDICTED: Homo sapiens cilia and flagella associated protein 97 (CFAP97), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CFAP97 (57587)
Length:
6048
CDS:
40..1638

Additional Resources:

NCBI RefSeq record:
XM_017008484.2
NBCI Gene record:
CFAP97 (57587)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017008484.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000268639 GTCCGTACAGCTTGGTTATAA pLKO_005 1618 CDS 100% 15.000 21.000 N CFAP97 n/a
2 TRCN0000268678 ATCCACTCTTGGCCAATATAG pLKO_005 1482 CDS 100% 13.200 18.480 N CFAP97 n/a
3 TRCN0000268677 ATGGACTATCATCGCAATATG pLKO_005 1423 CDS 100% 13.200 18.480 N CFAP97 n/a
4 TRCN0000268680 TCGTGCATATTCCTATAATTC pLKO_005 1687 3UTR 100% 13.200 18.480 N CFAP97 n/a
5 TRCN0000268679 TCCGCTAAACCATCTACTAAC pLKO_005 490 CDS 100% 10.800 15.120 N CFAP97 n/a
6 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 5286 3UTR 100% 4.950 2.475 Y LOC387873 n/a
7 TRCN0000008902 CCTCCCAAAGTGTTGGGATTA pLKO.1 5320 3UTR 100% 1.080 0.540 Y GPR83 n/a
8 TRCN0000156315 CCTCCCAAAGTGTTGGGATTA pLKO.1 5320 3UTR 100% 1.080 0.540 Y MYORG n/a
9 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 5982 3UTR 100% 5.625 2.813 Y KLHL30 n/a
10 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 5982 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017008484.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12370 pDONR223 100% 83.4% 82.4% None (many diffs) n/a
2 ccsbBroad304_12370 pLX_304 0% 83.4% 82.4% V5 (many diffs) n/a
3 TRCN0000491464 CGAGTGGTTGACCCCTTCCATATA pLX_317 29.7% 83.4% 82.4% V5 (many diffs) n/a
Download CSV