Transcript: Human XM_017008627.1

PREDICTED: Homo sapiens jade family PHD finger 1 (JADE1), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
JADE1 (79960)
Length:
5658
CDS:
286..1875

Additional Resources:

NCBI RefSeq record:
XM_017008627.1
NBCI Gene record:
JADE1 (79960)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017008627.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000360164 CAGCGATGCTACGACAATATG pLKO_005 823 CDS 100% 13.200 10.560 N JADE1 n/a
2 TRCN0000363302 TGAATCCGGATGAGTACTATG pLKO_005 476 CDS 100% 10.800 8.640 N JADE1 n/a
3 TRCN0000019619 CGACAATATGAATCATGCCAT pLKO.1 834 CDS 100% 2.640 2.112 N JADE1 n/a
4 TRCN0000019620 CGGGAGCAGGATGTCTTATTT pLKO.1 1723 CDS 100% 15.000 10.500 N JADE1 n/a
5 TRCN0000019623 GCAGCGATGCTACGACAATAT pLKO.1 822 CDS 100% 13.200 9.240 N JADE1 n/a
6 TRCN0000019622 GCCTGAGGAAGTAGTGGATTT pLKO.1 1611 CDS 100% 10.800 7.560 N JADE1 n/a
7 TRCN0000019621 GTCAACTACTTGGTCCCAGAA pLKO.1 342 CDS 100% 4.050 2.835 N JADE1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017008627.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04153 pDONR223 100% 95.4% 94.3% None (many diffs) n/a
2 ccsbBroad304_04153 pLX_304 0% 95.4% 94.3% V5 (many diffs) n/a
3 TRCN0000473040 AGTAGGCCGCTGGACCCCAATTAC pLX_317 32.3% 95.4% 94.3% V5 (many diffs) n/a
Download CSV