Transcript: Human XM_017008779.1

PREDICTED: Homo sapiens N(alpha)-acetyltransferase 11, NatA catalytic subunit (NAA11), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NAA11 (84779)
Length:
2518
CDS:
182..871

Additional Resources:

NCBI RefSeq record:
XM_017008779.1
NBCI Gene record:
NAA11 (84779)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017008779.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254313 TAGTGAGGTGGAACCTAAATA pLKO_005 571 CDS 100% 15.000 21.000 N NAA11 n/a
2 TRCN0000265519 AGATGAGCTGAGACGACAAAT pLKO_005 646 CDS 100% 13.200 9.240 N NAA11 n/a
3 TRCN0000254316 TGATGTCCCGCATGGCCATAT pLKO_005 376 CDS 100% 10.800 7.560 N NAA11 n/a
4 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 2471 3UTR 100% 4.950 2.475 Y ERAP2 n/a
5 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2472 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017008779.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11264 pDONR223 100% 50% 48% None (many diffs) n/a
2 ccsbBroad304_11264 pLX_304 0% 50% 48% V5 (many diffs) n/a
3 TRCN0000465347 GAGCAGATTCTGTGTGGGACTGTG pLX_317 84.5% 50% 48% V5 (many diffs) n/a
Download CSV