Transcript: Human XM_017008928.2

PREDICTED: Homo sapiens cadherin 18 (CDH18), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CDH18 (1016)
Length:
3476
CDS:
907..3279

Additional Resources:

NCBI RefSeq record:
XM_017008928.2
NBCI Gene record:
CDH18 (1016)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017008928.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000055706 CGACACAATCAGACCAGGATT pLKO.1 3176 CDS 100% 4.950 6.930 N CDH18 n/a
2 TRCN0000055704 GCCAGGGAATATGATATTATT pLKO.1 2371 CDS 100% 15.000 12.000 N CDH18 n/a
3 TRCN0000434175 GTAGATGAACCACCACTATTT pLKO_005 2035 CDS 100% 13.200 9.240 N CDH18 n/a
4 TRCN0000251226 GTGTATTATCTGCCCATTATG pLKO_005 2593 CDS 100% 13.200 9.240 N Cdh18 n/a
5 TRCN0000055705 CCTGCCTGTAAATCCAAACTT pLKO.1 2496 CDS 100% 5.625 3.938 N CDH18 n/a
6 TRCN0000055703 GCTGGGACTATATTTATCATT pLKO.1 1195 CDS 100% 5.625 3.938 N CDH18 n/a
7 TRCN0000055707 CCTCAACATAGAAGGAGCAAA pLKO.1 1938 CDS 100% 4.950 3.465 N CDH18 n/a
8 TRCN0000438524 GGGTCAGTTCTTGCAACCTTG pLKO_005 3281 3UTR 100% 4.050 2.835 N CDH18 n/a
9 TRCN0000418237 GCAACCTTGTGGAATTTGCTT pLKO_005 3293 3UTR 100% 3.000 2.100 N CDH18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017008928.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05978 pDONR223 100% 99.7% 99.3% None (many diffs) n/a
2 ccsbBroad304_05978 pLX_304 0% 99.7% 99.3% V5 (many diffs) n/a
Download CSV