Transcript: Human XM_017008988.2

PREDICTED: Homo sapiens terminal nucleotidyltransferase 4A (TENT4A), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TENT4A (11044)
Length:
4364
CDS:
1431..3032

Additional Resources:

NCBI RefSeq record:
XM_017008988.2
NBCI Gene record:
TENT4A (11044)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017008988.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000365178 ACGGCTGATGTACAGATATTT pLKO_005 1485 CDS 100% 15.000 21.000 N TENT4A n/a
2 TRCN0000053035 CGGATCGAAACTGTGGTGAAA pLKO.1 1452 CDS 100% 4.950 6.930 N TENT4A n/a
3 TRCN0000053037 CCGTGTTCCATCAAAGTCCTT pLKO.1 1629 CDS 100% 2.640 3.696 N TENT4A n/a
4 TRCN0000053034 CGAGCCCTCATCTGTATCATA pLKO.1 2815 CDS 100% 5.625 4.500 N TENT4A n/a
5 TRCN0000365234 TTAGCTCATACAGCCTAATTT pLKO_005 1855 CDS 100% 15.000 10.500 N TENT4A n/a
6 TRCN0000377474 ACCTGGTGGTCTTCGGGAAAT pLKO_005 1549 CDS 100% 10.800 7.560 N TENT4A n/a
7 TRCN0000377473 ACTACCGGAGGTGGATCAAAG pLKO_005 2281 CDS 100% 10.800 7.560 N TENT4A n/a
8 TRCN0000053036 CCAACAATCAGACCAGGTTTA pLKO.1 2662 CDS 100% 10.800 7.560 N TENT4A n/a
9 TRCN0000053033 GCAGCTTTAGTACAGGTCTTT pLKO.1 1507 CDS 100% 4.950 3.465 N TENT4A n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1 5UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1 5UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017008988.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02605 pDONR223 100% 98.3% 98.3% None 0_1ins27 n/a
2 ccsbBroad304_02605 pLX_304 0% 98.3% 98.3% V5 0_1ins27 n/a
3 TRCN0000469345 TTTTTCCTTGTAATGGAGCAAATT pLX_317 17.8% 98.3% 98.3% V5 0_1ins27 n/a
4 ccsbBroadEn_07732 pDONR223 100% 98.2% 98.3% None 0_1ins27;765T>C n/a
5 ccsbBroad304_07732 pLX_304 0% 98.2% 98.3% V5 0_1ins27;765T>C n/a
6 TRCN0000475778 ACCTAGCGGCTTCTTATGCTTCAA pLX_317 21.2% 98.2% 98.3% V5 0_1ins27;765T>C n/a
Download CSV