Transcript: Human XM_017008997.1

PREDICTED: Homo sapiens sorting nexin 18 (SNX18), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SNX18 (112574)
Length:
2695
CDS:
195..1820

Additional Resources:

NCBI RefSeq record:
XM_017008997.1
NBCI Gene record:
SNX18 (112574)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017008997.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438604 GAGATGCCTATGACGCCATTG pLKO_005 1684 CDS 100% 6.000 8.400 N SNX18 n/a
2 TRCN0000166133 CTTCATCTCTAAGCGCAGGAA pLKO.1 1235 CDS 100% 2.640 1.848 N SNX18 n/a
3 TRCN0000166645 CCAACTTCTTCCTGACCCTTA pLKO.1 1408 CDS 100% 4.050 2.430 N SNX18 n/a
4 TRCN0000165826 GATCTGGTGGATGAACCACAT pLKO.1 1262 CDS 100% 4.050 2.430 N SNX18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017008997.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16073 pDONR223 0% 86.5% 86.6% None 270T>C;612T>C;1623_1623delTins250 n/a
2 ccsbBroad304_16073 pLX_304 0% 86.5% 86.6% V5 270T>C;612T>C;1623_1623delTins250 n/a
3 TRCN0000467806 CGGAATTGGTGCCGATAATAGGAT pLX_317 22% 86.5% 86.6% V5 270T>C;612T>C;1623_1623delTins250 n/a
Download CSV