Transcript: Human XM_017009636.2

PREDICTED: Homo sapiens erbb2 interacting protein (ERBIN), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ERBIN (55914)
Length:
6485
CDS:
255..4502

Additional Resources:

NCBI RefSeq record:
XM_017009636.2
NBCI Gene record:
ERBIN (55914)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017009636.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000303526 ATCCATTGCAAACCTTATTAA pLKO_005 512 CDS 100% 15.000 21.000 N ERBIN n/a
2 TRCN0000059068 GCAGCCAAGTACAACCGTTAA pLKO.1 2921 CDS 100% 10.800 15.120 N ERBIN n/a
3 TRCN0000299306 GCAGCCAAGTACAACCGTTAA pLKO_005 2921 CDS 100% 10.800 15.120 N ERBIN n/a
4 TRCN0000059070 GCACGAACATACAGCATAGAT pLKO.1 3627 CDS 100% 5.625 7.875 N ERBIN n/a
5 TRCN0000299305 GCACGAACATACAGCATAGAT pLKO_005 3627 CDS 100% 5.625 7.875 N ERBIN n/a
6 TRCN0000303527 GAACCACTGTACAGAATATAA pLKO_005 4664 3UTR 100% 15.000 12.000 N ERBIN n/a
7 TRCN0000369854 GACTCTATAGGAGGGTTAATA pLKO_005 1131 CDS 100% 15.000 12.000 N ERBIN n/a
8 TRCN0000059069 CGGGCTCAAGTTGCATTTGAA pLKO.1 1623 CDS 100% 5.625 3.938 N ERBIN n/a
9 TRCN0000059072 CGAAGTACAATCCAGCGACAA pLKO.1 3453 CDS 100% 4.050 2.835 N ERBIN n/a
10 TRCN0000059071 GCAATCAGAATAACAGCAATT pLKO.1 2194 CDS 100% 10.800 6.480 N ERBIN n/a
11 TRCN0000331636 GCAATCAGAATAACAGCAATT pLKO_005 2194 CDS 100% 10.800 6.480 N ERBIN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017009636.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08611 pDONR223 100% 96.1% 95.9% None (many diffs) n/a
2 TRCN0000472299 ATATAGGGACACAAAAATCGTTTA pLX_317 5.5% 96.1% 95.9% V5 (many diffs) n/a
3 ccsbBroad304_08611 pLX_304 12.4% 96% 85.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV