Transcript: Human XM_017009686.2

PREDICTED: Homo sapiens golgi phosphoprotein 3 (GOLPH3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GOLPH3 (64083)
Length:
3048
CDS:
927..1547

Additional Resources:

NCBI RefSeq record:
XM_017009686.2
NBCI Gene record:
GOLPH3 (64083)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017009686.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000111621 CGTGGCTGTATGTTAATTGAA pLKO.1 918 5UTR 100% 5.625 7.875 N Golph3 n/a
2 TRCN0000309862 CGTGGCTGTATGTTAATTGAA pLKO_005 918 5UTR 100% 5.625 7.875 N Golph3 n/a
3 TRCN0000146377 CGTTCTTGACAAATGGGTGAA pLKO.1 1310 CDS 100% 4.050 5.670 N GOLPH3 n/a
4 TRCN0000150069 CAGTTAAGAAATGTACGGGAA pLKO.1 1155 CDS 100% 2.160 3.024 N GOLPH3 n/a
5 TRCN0000319292 CAGTTAAGAAATGTACGGGAA pLKO_005 1155 CDS 100% 2.160 3.024 N GOLPH3 n/a
6 TRCN0000150176 GCTTGCTTCAATCATGGTTAT pLKO.1 2301 3UTR 100% 10.800 7.560 N GOLPH3 n/a
7 TRCN0000319365 GCTTGCTTCAATCATGGTTAT pLKO_005 2301 3UTR 100% 10.800 7.560 N GOLPH3 n/a
8 TRCN0000149772 GCTTGTGGAATGAGACGTAAA pLKO.1 969 CDS 100% 10.800 7.560 N GOLPH3 n/a
9 TRCN0000319362 GCTTGTGGAATGAGACGTAAA pLKO_005 969 CDS 100% 10.800 7.560 N GOLPH3 n/a
10 TRCN0000147628 GAGAAACAGAACTTCCTACTT pLKO.1 1218 CDS 100% 4.950 3.465 N GOLPH3 n/a
11 TRCN0000319293 GAGAAACAGAACTTCCTACTT pLKO_005 1218 CDS 100% 4.950 3.465 N GOLPH3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017009686.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03918 pDONR223 100% 69.1% 69.1% None 0_1ins276 n/a
2 ccsbBroad304_03918 pLX_304 0% 69.1% 69.1% V5 0_1ins276 n/a
Download CSV