Transcript: Human XM_017009688.1

PREDICTED: Homo sapiens methylcrotonoyl-CoA carboxylase 2 (MCCC2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MCCC2 (64087)
Length:
1174
CDS:
41..1138

Additional Resources:

NCBI RefSeq record:
XM_017009688.1
NBCI Gene record:
MCCC2 (64087)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017009688.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078422 CCCGAGCACTTCACATATCAA pLKO.1 252 CDS 100% 5.625 4.500 N MCCC2 n/a
2 TRCN0000424957 ATGAACGAGTGGAGCATATAA pLKO_005 210 CDS 100% 15.000 10.500 N MCCC2 n/a
3 TRCN0000427390 GAAGGTTGTGAGGAATCTAAA pLKO_005 904 CDS 100% 13.200 9.240 N MCCC2 n/a
4 TRCN0000078419 CCCAAGAAATTGCCATGCAAA pLKO.1 507 CDS 100% 4.950 3.465 N MCCC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017009688.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14242 pDONR223 100% 83.7% 79.2% None (many diffs) n/a
2 ccsbBroad304_14242 pLX_304 0% 83.7% 79.2% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000471039 TTTATATAAATTCTCAGTTGCATG pLX_317 35.2% 83.7% 79.2% V5 (not translated due to frame shift) (many diffs) n/a
4 ccsbBroadEn_08829 pDONR223 100% 62.5% 59.8% None (many diffs) n/a
5 ccsbBroad304_08829 pLX_304 0% 62.5% 59.8% V5 (many diffs) n/a
6 TRCN0000467380 AGCCAGCAACAATTAACCAACAAT pLX_317 21.3% 62.5% 59.8% V5 (many diffs) n/a
Download CSV