Transcript: Human XM_017009774.1

PREDICTED: Homo sapiens solute carrier family 34 member 1 (SLC34A1), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC34A1 (6569)
Length:
1684
CDS:
151..1122

Additional Resources:

NCBI RefSeq record:
XM_017009774.1
NBCI Gene record:
SLC34A1 (6569)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017009774.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045033 CTTCTTCAACATCTCGGGTAT pLKO.1 636 CDS 100% 4.050 2.835 N SLC34A1 n/a
2 TRCN0000045037 GAAGGTCATCAATACGGACTT pLKO.1 360 CDS 100% 4.050 2.835 N SLC34A1 n/a
3 TRCN0000045036 GTGGTTACAGACATGGGACTT pLKO.1 915 CDS 100% 4.050 2.835 N SLC34A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017009774.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06968 pDONR223 100% 50.4% 50.3% None 0_1ins948;836G>C n/a
2 ccsbBroad304_06968 pLX_304 0% 50.4% 50.3% V5 0_1ins948;836G>C n/a
3 TRCN0000474755 GTAAGGTGCCATCCTTACCCCAAG pLX_317 16.7% 50.4% 50.3% V5 0_1ins948;836G>C n/a
Download CSV