Transcript: Human XM_017009782.1

PREDICTED: Homo sapiens GRAM domain containing 2B (GRAMD2B), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GRAMD2B (65983)
Length:
2995
CDS:
330..1574

Additional Resources:

NCBI RefSeq record:
XM_017009782.1
NBCI Gene record:
GRAMD2B (65983)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017009782.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000137123 CCATCGGAATACCTCATGTTT pLKO.1 1593 3UTR 100% 5.625 7.875 N GRAMD2B n/a
2 TRCN0000137920 GCCATCGGAATACCTCATGTT pLKO.1 1592 3UTR 100% 4.950 6.930 N GRAMD2B n/a
3 TRCN0000138479 CGAGATTTCCATGCGACAGAA pLKO.1 1119 CDS 100% 4.950 6.435 N GRAMD2B n/a
4 TRCN0000137081 CGAACACACTCTCTTGGATAA pLKO.1 1849 3UTR 100% 10.800 7.560 N GRAMD2B n/a
5 TRCN0000133843 CCTGTTATGTTCTGGTTGAAA pLKO.1 2112 3UTR 100% 5.625 3.938 N GRAMD2B n/a
6 TRCN0000134066 GTCAGAAACTGTTGGAATCTT pLKO.1 1250 CDS 100% 5.625 3.938 N GRAMD2B n/a
7 TRCN0000137676 GCGAACACACTCTCTTGGATA pLKO.1 1848 3UTR 100% 4.950 3.465 N GRAMD2B n/a
8 TRCN0000136589 CCCAAACAGTTCTGAATGTCT pLKO.1 1141 CDS 100% 3.000 2.100 N GRAMD2B n/a
9 TRCN0000137483 GCAGATGAGAATCCAGACATT pLKO.1 1678 3UTR 100% 4.950 2.970 N GRAMD2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017009782.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04000 pDONR223 100% 89.5% 82.7% None 0_1ins97;107_149del n/a
2 ccsbBroad304_04000 pLX_304 0% 89.5% 82.7% V5 0_1ins97;107_149del n/a
Download CSV