Transcript: Human XM_017009783.1

PREDICTED: Homo sapiens GRAM domain containing 2B (GRAMD2B), transcript variant X13, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GRAMD2B (65983)
Length:
1699
CDS:
199..1203

Additional Resources:

NCBI RefSeq record:
XM_017009783.1
NBCI Gene record:
GRAMD2B (65983)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017009783.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000138479 CGAGATTTCCATGCGACAGAA pLKO.1 730 CDS 100% 4.950 6.435 N GRAMD2B n/a
2 TRCN0000134066 GTCAGAAACTGTTGGAATCTT pLKO.1 861 CDS 100% 5.625 3.938 N GRAMD2B n/a
3 TRCN0000136589 CCCAAACAGTTCTGAATGTCT pLKO.1 752 CDS 100% 3.000 2.100 N GRAMD2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017009783.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04000 pDONR223 100% 72.8% 71.5% None (many diffs) n/a
2 ccsbBroad304_04000 pLX_304 0% 72.8% 71.5% V5 (many diffs) n/a
Download CSV