Transcript: Human XM_017009844.2

PREDICTED: Homo sapiens receptor accessory protein 5 (REEP5), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
REEP5 (7905)
Length:
2827
CDS:
100..873

Additional Resources:

NCBI RefSeq record:
XM_017009844.2
NBCI Gene record:
REEP5 (7905)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017009844.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000117841 CGGCGTGAACAGGAGCTTCAT pLKO.1 189 CDS 100% 1.650 2.310 N REEP5 n/a
2 TRCN0000300829 CGGCGTGAACAGGAGCTTCAT pLKO_005 189 CDS 100% 1.650 2.310 N REEP5 n/a
3 TRCN0000117838 CCAGCCTACATCTCAATTAAA pLKO.1 298 CDS 100% 15.000 10.500 N REEP5 n/a
4 TRCN0000300827 CCAGCCTACATCTCAATTAAA pLKO_005 298 CDS 100% 15.000 10.500 N REEP5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017009844.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11247 pDONR223 100% 70.3% 65.3% None (many diffs) n/a
2 ccsbBroad304_11247 pLX_304 0% 70.3% 65.3% V5 (many diffs) n/a
3 TRCN0000468254 TCGACGGACATGGGAAAGATCAAC pLX_317 67.1% 70.3% 65.3% V5 (many diffs) n/a
Download CSV