Transcript: Human XM_017009879.2

PREDICTED: Homo sapiens lysophosphatidylcholine acyltransferase 1 (LPCAT1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LPCAT1 (79888)
Length:
3679
CDS:
574..1455

Additional Resources:

NCBI RefSeq record:
XM_017009879.2
NBCI Gene record:
LPCAT1 (79888)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017009879.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231881 GACTTAGAGTTGGCGGATATT pLKO_005 3442 3UTR 100% 13.200 18.480 N LPCAT1 n/a
2 TRCN0000231879 AGATAGGTATTGCGGAGTTTG pLKO_005 947 CDS 100% 10.800 15.120 N LPCAT1 n/a
3 TRCN0000056068 CGGATCAGACACATTTCGAAA pLKO.1 1328 CDS 100% 4.950 3.960 N LPCAT1 n/a
4 TRCN0000231880 TACCCGGATCAGACACATTTC pLKO_005 1324 CDS 100% 0.000 0.000 N LPCAT1 n/a
5 TRCN0000056069 GAAGATCACATTCGCTGACTT pLKO.1 1257 CDS 100% 4.950 3.465 N LPCAT1 n/a
6 TRCN0000056071 GAAGATAGGTATTGCGGAGTT pLKO.1 945 CDS 100% 4.050 2.835 N LPCAT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017009879.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12641 pDONR223 100% 74.5% 72.3% None (many diffs) n/a
2 ccsbBroad304_12641 pLX_304 0% 74.5% 72.3% V5 (many diffs) n/a
3 TRCN0000469713 CAATCGAATCGGACAGACAATCCG pLX_317 4.2% 74.5% 72.3% V5 (many diffs) n/a
Download CSV