Transcript: Human XM_017010087.2

PREDICTED: Homo sapiens clathrin interactor 1 (CLINT1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CLINT1 (9685)
Length:
3438
CDS:
176..1732

Additional Resources:

NCBI RefSeq record:
XM_017010087.2
NBCI Gene record:
CLINT1 (9685)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017010087.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000382392 ATCAACTGAAGAGTCCATTTA pLKO_005 2345 3UTR 100% 13.200 18.480 N CLINT1 n/a
2 TRCN0000382509 GACGACAAAGCATATTCATAT pLKO_005 946 CDS 100% 13.200 18.480 N CLINT1 n/a
3 TRCN0000061907 GCCAAGGCTACATTTATGTAT pLKO.1 317 CDS 100% 5.625 4.500 N CLINT1 n/a
4 TRCN0000286826 GCCAAGGCTACATTTATGTAT pLKO_005 317 CDS 100% 5.625 4.500 N CLINT1 n/a
5 TRCN0000307284 ACCACTCTTGAGTCCATATAT pLKO_005 2504 3UTR 100% 15.000 10.500 N CLINT1 n/a
6 TRCN0000379469 GAATTGGAGAAGAGTTTATAA pLKO_005 397 CDS 100% 15.000 10.500 N CLINT1 n/a
7 TRCN0000061903 GCCACCAATGTTGTTATGAAT pLKO.1 215 CDS 100% 5.625 3.938 N CLINT1 n/a
8 TRCN0000061905 GCCATCACTGAATACAATGAT pLKO.1 1675 CDS 100% 5.625 3.938 N CLINT1 n/a
9 TRCN0000286751 GCCATCACTGAATACAATGAT pLKO_005 1675 CDS 100% 5.625 3.938 N CLINT1 n/a
10 TRCN0000061906 CCAGAGTATGAATTTCTCTAT pLKO.1 1486 CDS 100% 4.950 3.465 N CLINT1 n/a
11 TRCN0000286776 CCAGAGTATGAATTTCTCTAT pLKO_005 1486 CDS 100% 4.950 3.465 N CLINT1 n/a
12 TRCN0000061904 CGCACAGCAAATCCTTCCAAA pLKO.1 1004 CDS 100% 4.950 3.465 N CLINT1 n/a
13 TRCN0000286749 CGCACAGCAAATCCTTCCAAA pLKO_005 1004 CDS 100% 4.950 3.465 N CLINT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017010087.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02227 pDONR223 100% 82.1% 81.7% None (many diffs) n/a
2 ccsbBroad304_02227 pLX_304 0% 82.1% 81.7% V5 (many diffs) n/a
3 TRCN0000491415 TGCCAATCTTGTCCGAACTTAGGA pLX_317 16.7% 82.1% 81.7% V5 (many diffs) n/a
Download CSV