Transcript: Human XM_017010207.2

PREDICTED: Homo sapiens katanin catalytic subunit A1 (KATNA1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KATNA1 (11104)
Length:
2017
CDS:
383..1858

Additional Resources:

NCBI RefSeq record:
XM_017010207.2
NBCI Gene record:
KATNA1 (11104)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017010207.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229375 ATGGGATGATATCGCTGATTT pLKO_005 1003 CDS 100% 13.200 18.480 N KATNA1 n/a
2 TRCN0000116647 GCCTTGAGAAACGAATCTATA pLKO.1 1497 CDS 100% 13.200 18.480 N KATNA1 n/a
3 TRCN0000116648 CCCGAATTCTTTAAGGGCATT pLKO.1 1076 CDS 100% 0.000 0.000 N KATNA1 n/a
4 TRCN0000218329 ATTCTCCAGCCACCATATTTA pLKO_005 1281 CDS 100% 15.000 10.500 N KATNA1 n/a
5 TRCN0000229373 GACTCTGCGATGGTCTATTAT pLKO_005 449 CDS 100% 15.000 10.500 N KATNA1 n/a
6 TRCN0000229376 GGTTCTGGCAGCTACTAATTT pLKO_005 1444 CDS 100% 15.000 10.500 N KATNA1 n/a
7 TRCN0000229374 TGATAGTACCGGATATGATAA pLKO_005 928 CDS 100% 13.200 9.240 N KATNA1 n/a
8 TRCN0000116651 GTCTATTATCAGGGAGTTCTT pLKO.1 461 CDS 100% 4.950 3.465 N KATNA1 n/a
9 TRCN0000116650 CCTGGGATATAGATGAGGCTT pLKO.1 1467 CDS 100% 2.640 1.848 N KATNA1 n/a
10 TRCN0000116649 GCCCGAATTCTTTAAGGGCAT pLKO.1 1075 CDS 100% 0.000 0.000 N KATNA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017010207.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11595 pDONR223 100% 62.9% 62.5% None (many diffs) n/a
2 ccsbBroad304_11595 pLX_304 0% 62.9% 62.5% V5 (many diffs) n/a
3 TRCN0000471804 AGGGCCGCGCCCCGAAAGTTCATT pLX_317 49% 62.9% 62.5% V5 (many diffs) n/a
Download CSV