Transcript: Human XM_017010242.2

PREDICTED: Homo sapiens TATA-box binding protein associated factor 8 (TAF8), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TAF8 (129685)
Length:
4646
CDS:
373..1143

Additional Resources:

NCBI RefSeq record:
XM_017010242.2
NBCI Gene record:
TAF8 (129685)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017010242.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230224 CTAACCCTGCCGATAACTATC pLKO_005 251 5UTR 100% 10.800 15.120 N TAF8 n/a
2 TRCN0000016751 GCGGGCACTTACCCGTTTCAT pLKO.1 744 CDS 100% 1.875 2.625 N TAF8 n/a
3 TRCN0000016748 CGTCAGCACATTTCCATTGAT pLKO.1 804 CDS 100% 5.625 4.500 N TAF8 n/a
4 TRCN0000218362 AGAGAACCTTGCTCTTCATAT pLKO_005 936 CDS 100% 13.200 9.240 N TAF8 n/a
5 TRCN0000016749 CAGAGCTACATTTCAGAAATT pLKO.1 379 CDS 100% 13.200 9.240 N TAF8 n/a
6 TRCN0000257139 TGAACTGGAGATGCAACAAAT pLKO_005 873 CDS 100% 13.200 9.240 N TAF8 n/a
7 TRCN0000230225 ACATCATCGATAACCCTTATC pLKO_005 1046 CDS 100% 10.800 7.560 N TAF8 n/a
8 TRCN0000016752 ACAGAGAACCTTGCTCTTCAT pLKO.1 934 CDS 100% 4.950 3.465 N TAF8 n/a
9 TRCN0000072628 CCTCCCAAAGTGCTAGGATTA pLKO.1 3961 3UTR 100% 10.800 5.400 Y MRPS16 n/a
10 TRCN0000140657 CCTCCCAAAGTGCTAGGATAA pLKO.1 3961 3UTR 100% 10.800 5.400 Y CD3EAP n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2994 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 2861 3UTR 100% 2.640 1.320 Y LINC01098 n/a
13 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2994 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017010242.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13147 pDONR223 100% 77% 76.1% None (many diffs) n/a
2 ccsbBroad304_13147 pLX_304 0% 77% 76.1% V5 (many diffs) n/a
3 TRCN0000467148 TTCCATGCTATTCTTCTTCCACAT pLX_317 16.2% 77% 76.1% V5 (many diffs) n/a
4 ccsbBroadEn_13146 pDONR223 100% 34.2% 31.9% None (many diffs) n/a
5 ccsbBroad304_13146 pLX_304 0% 34.2% 31.9% V5 (many diffs) n/a
6 TRCN0000473773 CGGGTATGAAGAAAAACTTAAGCG pLX_317 87.2% 34.2% 31.9% V5 (many diffs) n/a
Download CSV