Transcript: Human XM_017010308.2

PREDICTED: Homo sapiens sterile alpha motif domain containing 3 (SAMD3), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SAMD3 (154075)
Length:
1336
CDS:
99..1223

Additional Resources:

NCBI RefSeq record:
XM_017010308.2
NBCI Gene record:
SAMD3 (154075)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017010308.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245492 ACCTTGATAATGGACTAATTG pLKO_005 499 CDS 100% 13.200 18.480 N SAMD3 n/a
2 TRCN0000172739 GCCGCTCTTCTTGCACTTAAT pLKO.1 255 CDS 100% 13.200 18.480 N SAMD3 n/a
3 TRCN0000167864 GAGTATTGAAACAGAGAAGAA pLKO.1 526 CDS 100% 4.950 6.930 N SAMD3 n/a
4 TRCN0000253023 GCCCTCAAAGATCGCTTTAAA pLKO_005 828 CDS 100% 15.000 12.000 N Samd3 n/a
5 TRCN0000245493 AGGCCGACATGACTAAGTATC pLKO_005 694 CDS 100% 10.800 7.560 N SAMD3 n/a
6 TRCN0000245494 ATGGTTCAGCAACTGGTAAAG pLKO_005 282 CDS 100% 10.800 7.560 N SAMD3 n/a
7 TRCN0000245490 TTTAGGAGAGCTAGTTCATAG pLKO_005 209 CDS 100% 10.800 7.560 N SAMD3 n/a
8 TRCN0000167010 GCTGTTCTGATGGATTTAATT pLKO.1 318 CDS 100% 15.000 9.000 N SAMD3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017010308.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09706 pDONR223 100% 58.5% 58% None (many diffs) n/a
2 ccsbBroad304_09706 pLX_304 0% 58.5% 58% V5 (many diffs) n/a
3 TRCN0000470354 AAGCATGACCCCTATGGCTCGTTA pLX_317 78.5% 58.4% 21.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV